[MOL] P-53 amd Bladder Cancer [00026] Medicine On Line


[Date Prev][Date Next][Thread Prev][Thread Next][Date Index][Thread Index]

[MOL] P-53 amd Bladder Cancer



Title: IMMUNOTHERAPY OF BLADDER CANCER TARGETING P53
Abstract: Hyclone Laboratories, Inc., Logan, UH), 100U/ml.
  penicillin, 100 g./ml. streptomycin and 2 mM L-glutamine.
  The HLA status (A2.1 + or -) of each cell line was
  determined by polymerase chain reaction (PCR) on genomic
  DNA using the primers 5 GGTCCCCAGGTCCACTCG-GTG3 and 5
  CTCGTCCCCAGGCTCTCACTCC3 . Surface HLA A2.1 expression was
  confirmed by indirect immunofluorescence (IF) using
  the...
Source: Journal of Urology
http://webmedlit.silverplatter.com/j/381cf62628/

__________________________________________________________

Warmly, lillian
 
We invite you to take a look at our Album.                                               
www.angelfire.com/sc/molangels/index.html
 
  ( Very informational, good tips, Molers pictures, art work and much more....